ctsR [2020-04-04 14:52:21]

transcription repressor of class III heat shock genes (clpC operon, clpE, clpP)

Locus: BSU_00830

Isoelectric point: 9.26

Molecular weight: 17.60 kDa

Protein length: 154 aa

Gene length: 465 bp

Function: regulation of protein degradation

Product: transcription repressor

Essential: no

Synonyms: yacG

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Proteolysis → Additional proteins involved in proteolysis
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)
• Lifestyles → Coping with stress → Heat shock proteins
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 101,449 101,913

The protein

Protein family

• CtsR family (single member, according to UniProt)

Modification

• phosphorylated on Arg-55 (phosphorylation serves as tag for degradation by ClpC-ClpP) PubMed
• phosphorylation of a tyrosine residue by McsB PubMed
• recently, it was reported that CtsR is phosphorylated by McsB on Arg-62 rather than on a tyrosine residue PubMed
• in addition, Arg-15 was reported to be a phosphorylation site PubMed

Effectors of protein activity

• CtsR is inactivated by heat, heat sensing requires Gly-64 PubMed
• non-phosphorylated McsB targets CtsR for degradation PubMed
• regulated proteolysis by ClpP/ClpC PubMed

Structure

• 3H0D (complex with a 26bp DNA duplex, from Geobacillus stearothermophilus) PubMed
• 6FH4 (C-terminal domain bound to phosphoarginine) PubMed

Additional information

• subject to Clp-dependent proteolysis upon glucose starvation PubMed
• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: ctsR-mcsA-mcsB-clpC-radA-disA
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon
  • SigA: sigma factor, PubMed, in SigA regulon
  • SigB: sigma factor, PubMed PubMed, in SigB regulon
  • SigF: sigma factor, PubMed, in SigF regulon

  Regulatory mechanism

  • CtsR: repression, PubMed, in CtsR regulon
  • Spx: activation, PubMed, in Spx regulon

  Regulation

  • expressed during germination and spore outgrowth PubMed
  • induction during diamide stress (Spx) PubMed

Additional information

• the mRNA is very stable (> 15 min) PubMed

Biological materials

Mutant

• MGNA-B928 (yacG::erm), available at the NBRP B. subtilis, Japan
• ctsR::aphA3 availbale in Ulf Gerth's lab
• BKE00830 (ctsR::erm, available in the BGSC and in Jörg Stülke's lab) PubMed
• BKE00830 (ctsR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTCAACCCCCTCCTTTAC, downstream forward: _UP4_AAATTAAAATAAGCGGGTGA
• BKK00830 (ctsR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTCAACCCCCTCCTTTAC, downstream forward: _UP4_AAATTAAAATAAGCGGGTGA

Expression vectors

• for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Ulf Gerth's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

• available in Ulf Gerth's lab

References

Reviews

Loading

Original Publications

Loading